Home Page Appalti per Paese India: Offerte

Tender Notic (Offerte №93786762it)

Registrati

Condividi:
Nazione: India
Linguaggio: EN
Numero: 93786762
Data pubblicazione: 07-11-2023
Fonte:

Description

Tutte le informazioni sull'appalto sono chiuse.
Per ulteriori lavori con il sito, leggi le informazioni di seguito.

Chi siamo

Motore di ricerca leader per gare e acquisti in Russia e nel mondo

  • Il più grande database di appalti e fonti di approvvigionamento in Russia e nel mondo
  • Newsletter giornaliera gratuita secondo le tue impostazioni
  • Informazioni sui vincitori delle gare nel formato che ti serve
  • Comoda visualizzazione e caricamento delle informazioni

Scegli noi

Iniziare

Registrazione al sito, dopodiché sono disponibili le seguenti funzionalità del sito:

  • Iscriviti alle mailing list gratuite per le tue frasi chiave
  • Visualizza annunci di gara
  • Esporta informazioni di riepilogo in formato Excel
  • Visualizza parte delle informazioni sui vincitori, fornitori e clienti delle gare

Registrazione

Per utilizzare tutte le funzioni del sito e visualizzare tutte le informazioni, devi registrare un account commerciale

  • Tariffa selezionata
  • Paga per l'accesso in uno qualsiasi dei modi possibili

Accesso completo
Quotations are hereby invited for the following: Provide Catering for Mthatha. Specifications: - Date: 20 November 2023, No of people: 20; - Date: 21 November 2023, No of people: 20; - Date: 22 November 2023, No of people: 20. Delivery address: Mthatha, Wonk’ Umntu Community Centre. Please note that this quotation was published late. Fonte: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: qPCR master mix. Scope: - Probe qPCR Master Mix - 500 reactions, Qty: 02. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Fonte: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probes and Primers. Scope: - qPCR Probe: ProFsgq1 - TGAATGCCATAGGTCAGAT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FSGq - TCTTCTAGGATGGGCTGGT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FVMGB - ACTCAGCGCCCAGGA with FAM+MGBNFQ, Qty: 1; - Probe: FvIGS - ATAGGGTAGGCGGATCTGACTTGGCG with FAM+TAMRA, Qty: 1; - qPCR Probe: FvPrb3 - TTTGGTCTAGGGTAGGCCG with FAM+MGBNFQ, Qty: 1; - Probe: FbPrb1 - TGGGATGCCCT+AATTTTT+ACGG with HEX + 3IABkFQ, Qty: 1; - Primer: Fsgq1F - GATACCCAAGTAGTCTTTGCAGTAAATG, Qty: 1; - Primer: FSGq1 - GGCTGAACTGGCAACTTGGA, Qty: 1; - Primer: FVF - GCAGGCCATGTTGGTTCTGTA, Qty: 1; - Primer: FvIGSF1 - GGTGGTGCGGAAGGTCT, Qty: 1; -Primer: F63 - GTAAGTGAGATTTAGTCTAGGGTAGGTGAC, Qty: 1; - Primer: FbF2 - AGGTCAGATTTGGTATAGGGTAGGTGAGA, Qty: 1; - Primer: Fsgq1R - TTAATGCCTAGTCCCCTATCAACAT, Qty: 1; - Primer: FSGq2 - CAAAGCTTCATTCAATCCTAATACAATC, Qty: 1; - Primer: FVR: GCACGTAAAGTGAGTCGTCTCATC, Qty: 1; - Primer: FvIGSR3 - GTGAGTCGTCTCATC, Qty: 1; - Primer: R6 - GGGACCACCTACCCTACACCTACT, Qty: 1; - Primer: FbR2 - CGGACCATCCGTCTGGGAATTT, Qty: 1. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Fonte: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probe and Primers. Scope: - DNA Probe: 33P-GGATGGCAACGTACGTGACCCT with 6FAM + IBFQ, Qty: 01; - DNA Primer: 382F-ACCCAACAGACACTGTGCTC, Qty: 02; - DNA Primer: 49R-CAGTTTGTCAGTAATCGGTATTCG, Qty: 02. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Fonte: ONLINE TENDERS

Extension of Closing Date: Bids are hereby invited for the following: Establishment of a panel of legal practitioners (attorneys and advocates) to the state for a period of thirty-six (36) months. Province: National. Fonte: ONLINE TENDERS

Addendum: Extension of Closing Date and Amendment to Document: Quotations are hereby invited for the appointment of a service provider to assist the DFFE/MLRF to conduct socio-economic study on hake handline, oysters, and white mussels for a period of 12 months. Scope: The study shall include but not limited to: - Evaluate the economic performance of the hake handline, oysters, and white mussel commercial fishing sectors, including revenue, profitability, and contribution to the local and national economy; - Examine the social implications of the hake handline, oysters, and white mussel commercial fishing sectors, including their role in providing employment, income distribution, and community well-being, particularly among small scale fishers; - Map out the entire value chains for the hake handline, oysters, and white mussel commercial fishing sectors, from harvesting and processing to distribution and consumption, highlighting key stakeholders and interactions. Delivery Address: Foretrust building, Cape Town, 8001. Please confirm the contract number as two were published. Fonte: ONLINE TENDERS